Abstract


Close Window



Identification of Six Novel SOD1 Gene Mutations in Familial Amyotrophic Lateral Sclerosis

Y. Boukaftane, J. Khoris, B. Moulard, F. Salachas, V. Meininger, A. Malafosse,

W. Camu and G.A. Rouleau

Abstract: Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease characterized by the premature death of motor neurons. In approximately 10% of the cases the disease is inherited as autosomal dominant trait (FALS). It has been found that mutations in the Cu/Zn superoxide dismutase gene (SOD1) are responsible for approximately 15% of FALS kindreds. We screened affected individuals from 70 unrelated FALS kindreds and identified 10 mutations, 6 of which are novel. Surprisingly, we have found a mutation in exon 3, which includes most of the active site loop and Zn2+ binding sites, a region where no previous SOD1 mutations have been found. Our data increase the number of different SOD1 mutations causing FALS to 55, a significant fraction of the 154 amino acids of this relatively small protein.


Amyotrophic lateral sclerosis (ALS) is a fatal neurological disorder characterized by progressive degeneration of large motor neurons in the motor cortex, brainstem and spinal cord. The mean age at onset of the disease is 45 years with a mean survival of 3 years.1,2 ALS occurs in two clinically indistinguishable forms, sporadic (SALS; 90%) and familial (FALS; 10%). FALS is usually inherited as autosomal dominant trait3 though a few kindreds show autosomal recessive inheritance.4,5

Approximately 15% of all dominant FALS are caused by a defect in the cytosolic Cu/Zn superoxide dismutase gene (SOD1) localized to human chromosome 21q22.1.6,7 To date forty-five different missense mutations affecting 34 codons, one nonsense mutation, one deletion mutation causing a frameshift and two intronic mutation in intron 4 have been described in the SOD1 gene.8 All the SOD1 mutations are dominant except for the Asp90Ala mutation which is thought to be recessive.5,9 In order to study the effect of these mutations and to gain insight into the mechanisms leading to motor neuron degeneration animal models of FALS have been generated using mutant SOD1 transgenes.10,12

We have screened genomic DNA from 70 unrelated patients for mutations in the SOD1 gene by PCR-SSCP. Here, we report six new and unpublished SOD1 gene mutations found in six unrelated patients.

PATIENTS AND METHODS

Patients

Blood was collected from 70 unrelated patients with FALS. These FALS kindreds were of Canadian and French origins. The El

Can J Neurol Sci 1998; 25: 192


Escorial diagnostic criteria were used.13 Genomic DNA was prepared from blood using standard procedures.

Primer design, SSCP analysis and direct sequencing

To improve the PCR amplification of SOD1 gene exons for SSCP screening, we designed new intronic primers for exons 1 to 3 (Table 1). PCR amplification of exons 4 and 5 was performed using primers as previously described.14

The 50 µl amplification reaction contained 100 ng of genomic DNA, 1X PCR buffer (Promega), 100 ng of each primer, 50 µM of dCTP, 50 µM of dGTP, 50 µM of dTTP, 25 µM of dATP, 12.5 µM of (a-35S)-dATP (1,000 mCi/mmol, Amersham) and 1.5 units of Taq polymerase (Promega). All SOD1 gene exons were amplified using thirty cycles of amplification: 30 s at 94°C, 30 s at 59°C (62°C for exon 2) and 45 s at 72°C followed by a 5-min extension at 72°C.

The single-strand conformational polymorphism (SSCP) analysis15 was performed as described by Michaud et al.16 except for using an acrylamide concentration of 8% in the gels. In order to maximize the mutation detection, we also used the 0.5X Hydrolink MDE gel supplemented with or without 5% glycerol. Electrophoretic migration at 6V and autoradiology were performed for 16 and 18 hours, respectively. Any difference in migration between patient and control samples was noted as positive. To confirm the SSCP results, symmetric direct sequencing method17,18 using modified T7 polymerase (sequenase, Amersham) was used as described by Brody et al.19 All exons were sequenced at least once on each strand.

RESULTS

In our hands the new oligonucleotide primers designed to amplify exons 1-3 (Table 1) gave clearer and more intense bands on SSCP than those described in reference 14. Genomic DNA from 70 unrelated FALS affected patients and from 26 normal controls were screened for mutations in SOD1 gene in all 5 exons using primers from the flanking intron sequences. PCR-SSCP analysis of all DNA samples showed variant bands in 10 unrelated families (14.3%). We had previously screened 300 controls for mutations in these exons; none were found.

Direct sequencing of PCR-amplified DNA from the 10 FALS individuals with SSCP variants confirmed the presence of mutations in all cases. We identified 6 new mutations of which 5 were missense nucleotide substitutions and one 3 bp deletion in intron 4 (Table 2). Two other known mutations were found in four patients (Asp90Ala and Ile113Thr).5,20 All affected patients with the SOD1 mutations are heterozygotes except for Leu84Phe and Asp90Ala amino acid substitutions where patients were homozygous. The 3 bp (CTT) deletion detected in intron 4 is 30 bp downstream of exon-intron splice junction.

DISCUSSION

All 5 exons of the SOD1 gene from 70 unrelated FALS affected patients were screened for mutations using SSCP. Using our SSCP protocol, which involves testing of DNA fragments smaller than 300 bp using many different gel conditions, we expect to have

Table 1: Amplified DNA length, annealing temperature and oligonucleotide primer sequences for PCR amplification of Human SOD1 gene exons.

DNA
length
Annealing temperature
Oligonucleotide primers

Exon

(bp)

(ºC)

Forward
Reverse

1

209

55

5' CGTCTGGGGTTTCCGT 3'

5' CGTCCATGCAAAGGGT 3'

2

260

62

5' GTCTGGCTGCTTTTTACTTCA 3'

5' GGGGCTACTCTACTGTTTACT 3'

3

342

59

5' CTTGTTTCTGTTCCCTTCT 3'

5' GGGAAACACGGAATTATCT 3'

4

242

59

5' CATCAGCCCTAATCCATCTGA 3'

5' TGGATCTTAGAATTCGCGAC 3'

5

249

59

5' GTAGTGATTACTTGACAGCCCA 3'

5' AACAGATGAGTTAAGGGGCCT 3'

Table 2: Novel SOD1 mutations in familial amyotrophic lateral sclerosis.

Codon
changes
Restriction site
changes
Amino acid
substitution

Structural locationa

Mammalian
amino acid identityb

Exon 2

GAG6 GGG
CTG6 CGG
GAG6 AAG
&endash;Taq I
 
&endash;BspH I
&endash;Nla III
Glu 21 Gly
Leu 38 Arg
Glu 49 Lys
ß strand
Greek key
Cu2+ binding site
or dinner contact
8/8
8/8
3/8

Exon 3

CTA6 CGA

+Taq I,
+Mbo I
+Sau3A I

Leu 67Arg

Active site loop

6/8

Exon 4

TTG6 TTC

 

Leu 84 Phe

Zinc binding site

8/8

Intron 4

AAAACTTCTTCTAA6 AAAACTTCTAA

a Structural location is predicted as reported by H.X. Deng et al.21
b Frequency in which amino acid is conserved in 8 different mammals.
+ and - indicate a gain and loss of the corresponding restriction site.

 

Can J Neurol Sci 1998; 25: 193


Figure: Amino acid sequence comparison of the SOD1 protein in 15 different species.

All SOD1 protein sequences were obtained from GenBank. The protein sequence comparison was performed using DNASTAR package software (DNASTAR Inc., Wisconsin). The amino acids representing the novel mutations reported in this article are boxed. Hyphens indicate amino acid deletions.

Actual figure not available on-line.

Can J Neurol Sci 1998; 25: 194


detected over 90% of all mutations, suggesting that few, if any, were missed in our screen. Therefore, 14.3% of our FALS families showed a defect in the SOD1 gene, confirming the relatively low prevalence of SOD1 mutations found in previous studies.8,22

We found three new mutations in exon 2 replacing Glu 21 by Gly, Leu 38 by Arg and Glu 49 by Lys. At the position 21, a Glu21Lys mutation was previously reported in one sporadic case of ALS.23 The SOD1 protein of all compared species in the Figure contain the Glu 21, except chicken and nematodes, showing that this amino acid is highly conserved. Based on the bovine and yeast crystallographic SOD1 protein structure21 Glu 21 is part of a b strand. Thus the Glu21Gly mutation may destabilize the SOD1 structure. As predicted for Leu38Val mutation,21 Leu38Arg would be expected to destabilize protein folding by altering a Greek Key. The bovine and yeast crystallographic SOD1 protein structure21 show that Glu 49 is involved in dimer contact or Cu2+ binding. While the amino acid Glu 49 is not highly conserved between species, this substitution constitutes a significant amino acid change from a negatively charged (Glu) to a positively charged (Lys) amino acid.

In exon 4 we found another novel mutation, Leu84Phe, and two previously published mutations Asp90Ala and Ile113Thr in six unrelated families. One of our families carrying an Asp90Ala mutation contains two affected patients and two normal individuals who are homozygotes and heterozygotes, respectively for the mutation (B. Moulard and Y. Boukaftane, in preparation). This finding supports a recessive inheritance mechanism for the Asp90Ala mutation.5,9 The Leu 84 amino acid is conserved in all known mammalian SOD1 genes (Figure), and it is a part of fourteen conserved amino acids region which would have an important role in SOD1 function. Surprisingly, the woman patient carrying the Leu84Phe mutation is homozygote. She died at the age of 43 years, 3 years after the onset of the disease. She has a 48-year-old normal sister found also to be homozygous for the same mutation.

We also found a deletion of three nucleotides 30 bp downstream of the exon-intron splice junction in intron 4. The consequence of this mutation is unknown. The patient and his parents have died and no cell line is available to test for splicing errors or other biological effects. However, the mutation is not seen in 600 control chromosomes.

We found one kindred showing a missense mutation (CTA to CGA; Leu67Arg) in exon 3 which encodes the Zn-binding loop of the active site. This mutation replaces a predicted Leu at position 67 by an Arg, introducing a voluminous amino acid with a positive charge, which constitutes a major structural change. The Zn2+ ion is known to be a potential neurotoxin.24-26 Therefore, the alteration of SOD1 role in the binding of Zn2+ may affect its homeostasis leading to neurodegeneration. We have found two different mutations involving the Zn2+ binding site (Leu67Arg and Leu84Phe), in two unrelated FALS patients suggesting a possible role of Zn2+ ions in the development of ALS.

This study increases the number of known mutations causing FALS to 55 involving 37 different codons. The fact that we have found 5 new missense mutations suggest there are other as yet undiscovered SOD1 mutations in FALS. This represents a surprisingly large number of gain of function mutations for such a small protein.

Abbreviations

ALS, Amyotrophic lateral sclerosis; FALS, familial ALS; SOD1, Cu/Zn superoxide dismutase1; SALS, sporadic ALS; SSCP, single strand conformational polymorphism.

ACKNOWLEDGEMENTS

We thank members of FALS kindreds for their cooperation. G.A.R. is supported by the Medical Research Council of Canada. The work was supported by the Muscular Dystrophy Association (U.S.A.), the ALS Association, the Association Française contre le Myopathie and the Association pour la recherche sur la sclérose laterale amyotrophique.

REFERENCES

1. Tandan R, Bradley WG. Amyotrophic lateral sclerosis: Part 1. Clinical features, pathology, and ethical issues in management. Ann Neurol 1985; 18: 271-280.

2. Tandan R, Bradley WG. Amyotrophic lateral sclerosis: Part 2. Etiopathogenesis. Ann Neurol 1985; 18: 419-431.

3. Mulder DS, Kurland LT, Offord KP, Beard CM. Familial adult motor neuron disease: amyotrophic lateral sclerosis. Neurology 1986; 36: 511-517

4. Hentati A, et al. Linkage of recessive familial amyotrophic lateral sclerosis to chromosome 2q33-q35. Nat Genet 1994; 7: 425-428.

5. Andersen PM, et al. Amyotrophic lateral sclerosis associated with homozygosity for an Asp90Ala mutation in CuZn-superoxide dismutase. Nat Genet 1995; 10: 61-66.

6. Rosen DR, et al. A frequent ala 4 to val superoxide dismutase-1 mutation is associated with a rapidly progressive familial amyotrophic lateral sclerosis. Hum Mol Genet 1994; 3: 981-987.

7. Siddique T, et al. Linkage of a gene causing familial amyotrophic lateral sclerosis to chromosome 21 and evidence of genetic-locus heterogeneity. N Engl J Med 1991; 324: 1381-1384.

8. Siddique T, Deng HX. Genetics of amyotrophic lateral sclerosis. Hum Mol Genet 1996: 1465-1470.

9. Andersen PM, et al. Autosomal recessive adult-onset amyotrophic lateral sclerosis associated with homozygosity for Asp90ala CuZn-superoxide dismutase mutation. A clinical and genealogical study of 36 patients. Brain 1996; 119: 1153-1172.

10. Gurney ME, et al. Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 1994; 264: 1772-1775.

11. Cleveland DW, et al. Mechanisms of selective motor neuron death in transgenic mouse models of motor neuron disease. Neurology 1996; 47: S54-S61; discussion S61-S62.

12. Kostic V, et al. Midbrain dopaminergic neuronal degeneration in a transgenic mouse model of familial amyotrophic lateral sclerosis. Ann Neurol 1997; 41: 497-504.

13. Brooks BR,. El Escorial World Federation of Neurology criteria for the diagnosis of amyotrophic lateral sclerosis. Subcommittee on Motor Neuron Diseases/Amyotrophic Lateral Sclerosis of the World Federation of Neurology Research Group on Neuromuscular Diseases and the El Escorial "Clinical limits of amyotrophic lateral sclerosis" workshop contributors. J Neurol Sci 1994; 124: S96-S107.

14. Yulug IG, Katsanis N, de Belleroche J, Collinge J, Fisher EM. An improved protocol for the analysis of SOD1 gene mutations, and a new mutation in exon 4. Hum Mol Genet 1995; 4: 1101-1104.

15. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. Detection of polymorphisms of human DNA by gel electrophoresis of single-strand conformation polymorphisms. Proc Natl Acad Sci USA 1989; 86: 2766-2770.

16. Michaud J, et al. Strand-separating conformational polymorphism analysis: efficacy of detection of point mutations in the human ornithine delta-aminotransferase gene. Genomics 1992; 13: 389-394.

17. Tahara T, Kraus JP, Rosenberg LE. Direct DNA sequencing of PCR amplified genomic DNA by the Maxam-Gilbert method. Biotechniques. 1990; 8: 366-368.

Can J Neurol Sci 1998; 25: 195


18. Kusukawa N, Uemori T, Asada K, Kato I. Rapid and reliable protocol for direct sequencing of material amplified by the polymerase chain reaction. Biotechniques 1990; 9: 66-72.

19. Brody LC, et al. Ornithine delta-aminotransferase mutations in gyrate atrophy. Allelic heterogeneity and functional consequences. J Biol Chem 1992; 267: 3302-3307.

20. Rosen DR, et al. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 1993; 362: 59-62.

21. Deng HX, et al. Amyotrophic lateral sclerosis and structural defects in Cu,Zn superoxide dismutase. Science 1993; 261: 1047-1051.

22. Pramatarova A, et al. Identification of new mutations in the Cu/Zn superoxide dismutase gene of patients with familial amyotrophic lateral sclerosis. Am J Hum Genet 1995; 56: 592-596.

23. Jones CT, Swingler RJ, Brock DJ. Identification of a novel SOD1 mutation in an apparently sporadic amyotrophic lateral sclerosis patient and the detection of Ile113Thr in three others. Hum Mol Genet 1994; 3: 649-650.

24. Ebadi M, Murrin LC, Pfeiffer RF. Hippocampal zinc thionein and pyridoxal phosphate modulate synaptic functions. Ann NY Acad Sci. 1990; 585: 189-201.

25. Choi DW, Yokayama M, Koh J. Zinc neurotoxicity in cortical cell culture. Neuroscience 1988; 24: 67-79.

26. Duncan MW, Marini AM, Watters R, Kopin IJ, Markey SP. Zinc, a neurotoxin to cultured neurons, contaminates cycad flour prepared by traditional guamanian methods. J Neurosci 1992; 12: 1523-1537.

Can J Neurol Sci 1998; 25: 196


From the Centre for Research in Neuroscience, McGill University, and the Montreal General Hospital Research Institute, Montreal, Canada, (Y.B., J.K., G.A.R.); Laboratoire de Médecine Expérimentale, Institut de Biologie, Montpelier, France (B.M.); Service de Neurologie, division Mazarin, Hôpital de la Salpétrière, Paris, France (F.S., V.M.); Division de Neuropsychiatrie, Hôpital Belle-Idée, Genève, Suisse (A.M.); Département de physiopathologie Neuromusculaire, Institut de Biologie, Montpelier, France (W.C.).

Received June 4, 1998. Accepted in final form June 5, 1998.

Reprint requests to: G.A. Rouleau: Rm L7 224, Department of Neurology, Montreal General Hospital, 1650 Cedar Avenue, Montreal, Quebec, Canada, H3G 1A4

Can. J. Neurol. Sci. 1998; 25: 192-196

 


 
For information about this web site e-mail to: journal@cjns.org